snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORA53
sequence
AACATGCTCCCTTAGATCCATCTTTGTGGAAGTCCGCTTATGCTGAGTCCTGCTAACTG
CTCATTTTGGGCTTTAGAAGTTCCAGCTAAGAGACAACCAGCAACTTTTTTGGTTGTACA
GTCAAAGGTGCTTGAGTCATTGGCATGTGAGACTAATATACCTGCACGTTTGTCTTGGCA
TTTTGATGGCCGTGGTTTCCTAACCACATGCCACCATCAGAATTTAGCAAATGTGCGGAC
ATA
  Box motif
  Complementary to target RNA
length 242
organism Xenopus_tropicalis
snoRNA name SNORA53
alias
chromosome ⁄ contig scaffold_5
locus ⁄ host gene SLC25A3
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved