snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD100
sequence
TTTACCTATGATGAGAATTTGGCTCCCTCTTCTGAAACTAGTGAGGAAATTGCCAATTG
TTACCCAATAATCTCTGAGGTGCA
  Box motif
  Complementary to target RNA
length 83
organism Xenopus_tropicalis
snoRNA name SNORD100
alias
chromosome ⁄ contig scaffold_11731
locus ⁄ host gene Mono:23:SNORD100
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved