snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD49
sequence
AAACATGATGAAATCTGGATATAGGAAGTGCCGTCAGATGCGATAACTGACGAGAACCT
TTTCCTGTTCTGACT
  Box motif
  Complementary to target RNA
length 74
organism Xenopus_tropicalis
snoRNA name SNORD49
alias
chromosome ⁄ contig scaffold_178
locus ⁄ host gene Poly:4:snoR38
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved