snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD12
sequence
GCTGACATGCATGATGACCAAACTTTTTTCCCCAACAGATCGACAGTGTTGACTTTGTT
GCTATTAAGCCAGTTTTGTCTGATATGTCTGT
  Box motif
  Complementary to target RNA
length 91
organism Xenopus_tropicalis
snoRNA name SNORD12
alias
chromosome ⁄ contig scaffold_48
locus ⁄ host gene Poly:2:SNORD12
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved