snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD75
sequence
AGCCAGTGATGCTTCAAAGAGTAGTGGACAGGTGTGATTTCTGACAGCTTGTAAAACTG
AGGCT
  Box motif
  Complementary to target RNA
length 64
organism Xenopus_tropicalis
snoRNA name SNORD75
alias
chromosome ⁄ contig scaffold_1
locus ⁄ host gene Poly:0:SNORD74
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved