snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD42
sequence
TTGCAAATGATGGAAATGTTATTTGGACTGAATACATTGATGAGCTCAAAGGAACCACT
GATGCAC
  Box motif
  Complementary to target RNA
length 66
organism Xenopus_tropicalis
snoRNA name SNORD42
alias
chromosome ⁄ contig scaffold_817
locus ⁄ host gene Mono:14:SNORD42
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved