snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD57
sequence
CGGAGATGATGTCAATCTTTTGCCCTGACCTGAAGCCATGAGGCAAAAACTGATTTAAT
GAGCCTGATCC
  Box motif
  Complementary to target RNA
length 70
organism Xenopus_tropicalis
snoRNA name SNORD57
alias
chromosome ⁄ contig scaffold_1626
locus ⁄ host gene Mono:20:SNORD57
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved