snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD77
sequence
ATGCCTATATAACTGCATTGTTCAGCAGATTGAATGTACAGTGCAGCTATGGCCGTATG
CCTAT
  Box motif
  Complementary to target RNA
length 64
organism Xenopus_tropicalis
snoRNA name SNORD77
alias
chromosome ⁄ contig scaffold_1172
locus ⁄ host gene Mono:19:SNORD77
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved