snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD53
sequence
CTGCAGTGATGAGTTGCCTCTGGTTTCGCTTGTGTCCGACAAGCTGTGACGACGCATCT
CTCTTGGCTGTCTGAGCAG
  Box motif
  Complementary to target RNA
length 78
organism Xenopus_tropicalis
snoRNA name SNORD53
alias
chromosome ⁄ contig scaffold_372
locus ⁄ host gene Mono:5:SNORD53
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved