snOPY snoRNA Orthological Gene Database
Xenopus_tropicalis SNORD27
sequence
TGTCAATGATGAATAAAATAGACAAGCATATGTCTGAATAGTATGTGTTGCCATCTTAT
TTTTTCTGAGAAA
  Box motif
  Complementary to target RNA
length 72
organism Xenopus_tropicalis
snoRNA name SNORD27
alias
chromosome ⁄ contig scaffold_782
locus ⁄ host gene Poly:8:SNORD26
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved