snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD52
sequence
TGGAATGATGATTTCACAGACTAGAGTCTCTGATGCTGGTTCTGATGCCAAATGCAAGT
TCTGACCC
  Box motif
  Complementary to target RNA
length 67
organism Tupaia_belangeri
snoRNA name SNORD52
alias
chromosome ⁄ contig GeneScaffold_5664
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved