snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SCARNA9
sequence
TCTCTGAGATCTGCTCTTACCGAAGTAGATCAATGATGAAACTAGCCAAATCTGAGCAT
CAGAAGACCTTCCAGGCTACCTGATGCATGATCTCTCTAGTTCTGAGAAGCAAAACTTAT
AGTGTAAAACAGAAAGGACTTATTATTATAGCTCTGGGTGTGCATGTGTGTGTATATGAA
GGTGACAGTGGATAACTGAGGATTGCTGAATGGTGAATGGGATATTGTGTGTGTGTGTGT
GTGTGTCTGTGTCTGTGTGTGTCTGTCTGTCTGTCTTTAAAGGCAAATCATTTCTGAGCG
ATGATGATAAGGTTTTCCTACTGACCTCTGTAACTCTGAAGGTTTTTACACTTGATCTGA
GCTCA
  Box motif
  Complementary to target RNA
length 364
organism Tupaia_belangeri
snoRNA name SCARNA9
alias
chromosome ⁄ contig GeneScaffold_4039
locus ⁄ host gene KIAA1731
organization Intronic
target RNA
modification type unknown
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved