snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA61
sequence
ACCCTCCGGTTCCCTTTCCCATTGGATCTGAACCTGGTCTTGGTGGTCGCATGAGGAGG
GAGAAGAACACTGAAGCCGGCCTCTGGTGGTGTCGCCTGGCTGCACCCTGGGGCTGGTTT
CAGACACAC
  Box motif
  Complementary to target RNA
length 128
organism Tupaia_belangeri
snoRNA name SNORA61
alias
chromosome ⁄ contig GeneScaffold_4051
locus ⁄ host gene LRRC49
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved