snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA4
sequence
ATACCAAAAGTAAAGTGTTTGGGGGGAAGGTTTTTCTGATAACCTTTACCACCTTGAGC
TATTTGGGAGATTAAGGACCACACTCCACAGTGGGCTATATCACTTAGTACAGTCCACTA
CTATTCTGTGGCCTACATG
  Box motif
  Complementary to target RNA
length 138
organism Tupaia_belangeri
snoRNA name SNORA4
alias
chromosome ⁄ contig GeneScaffold_1723
locus ⁄ host gene C5
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved