snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA11
sequence
GGGGTGTGCTCAGAGCAGGGGACCTCAAGAATGGGTCCTCTGTTTATAACACACCCAAC
AGAAATCTGGGATCATGATGTTAAGGGACACAAAACTTGTAGCCTCCCTATGAACAAATA
CCATACAAGT
  Box motif
  Complementary to target RNA
length 129
organism Tupaia_belangeri
snoRNA name SNORA11
alias
chromosome ⁄ contig GeneScaffold_5984
locus ⁄ host gene Q8HY80_TUPGB
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved