snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA2
sequence
TTGGCCCTGAATCAAGGCCAGCAGTTTGTTGAAGCTGTTGGTTTCAAGCAGGAGCCTAA
AGAAATGTCTTTCATGGTCTGTTGGTCATTTCAGAACTTTGGGAATGTAATGGCCAGTTC
ATTGGAAAGAAACATCT
  Box motif
  Complementary to target RNA
length 136
organism Tupaia_belangeri
snoRNA name SNORA2
alias
chromosome ⁄ contig GeneScaffold_1977
locus ⁄ host gene ENSTBEG00000004161
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved