snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD59
sequence
CCTTCCATGATGATCTTATCAAAATGACTTTCGTTCTTCTGAGTTTGCTGAAGCCATAT
TTATGTACTGAGAAGG
  Box motif
  Complementary to target RNA
length 75
organism Tupaia_belangeri
snoRNA name SNORD59
alias
chromosome ⁄ contig GeneScaffold_3011
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved