snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA68
sequence
CTCACACCCCAACCCAAGAGTCACTGTTGGTTGTTGCAGTGGTTTAAACAGAGGTGCAG
ATGGCAAGCAGGCCTCCTCGCCTTTGGGCAGCCGTGGCCGTGCCTCTCGAAGTGAATTTG
GAGGTTCCACAGCC
  Box motif
  Complementary to target RNA
length 133
organism Tupaia_belangeri
snoRNA name SNORA68
alias
chromosome ⁄ contig GeneScaffold_4114
locus ⁄ host gene DIS3L
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved