snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD42
sequence
GCACAATGATGGAAACAAACTATTTAGAAGAGAATGATATGAACAAAGGAACCACTGAT
GTGC
  Box motif
  Complementary to target RNA
length 63
organism Tupaia_belangeri
snoRNA name SNORD42
alias
chromosome ⁄ contig GeneScaffold_4804
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved