snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA53
sequence
AACATGCTTCCTTAGATCCACCTTTGTGGATGAATCTTGAACTGAGTTCTACTTGTAAA
CCTTGTTTCTTGTAGTTCCAGTCAAAAAACATCCAGCAACTTTTTTGGTTGTACAGTCAA
AGGTGCTTGAGTCATTGGCATGTGAGATAAATATACCTGCACATTAGTCTAAGGTTCTGA
TAGAAATGACATGCAGTTATGCTGCCATTTTCCACTGTCAGGACTTGACTGGTGTGCGGA
CACT
  Box motif
  Complementary to target RNA
length 243
organism Tupaia_belangeri
snoRNA name SNORA53
alias
chromosome ⁄ contig GeneScaffold_484
locus ⁄ host gene SLC25A3
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved