snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA46
sequence
AGCACTATATTTAAGCCGATGGATGGGAACTTTCCCCATTCTTGGTTACGCTGTAGTGC
AAAAGAATTCCTGACTCTTTGATGCATAGCTGACTTGCACCATTCTGCTGTTGCATTATG
GAGTTAAGGAACATAT
  Box motif
  Complementary to target RNA
length 135
organism Tupaia_belangeri
snoRNA name SNORA46
alias
chromosome ⁄ contig GeneScaffold_963
locus ⁄ host gene CNOT1
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved