snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA21
sequence
CCCTTTTTAAAAGCACTCAGTGGGCCTTTGCAAATGACCCACTGAGCCGTCAAGAAAGG
GCAGAGTAAAAACACCACTTTTGGGTGAAGTGGCAGCGTGTTGTGTTGTTTTGCTTCAAT
CCGTGGTGTGACAAGG
  Box motif
  Complementary to target RNA
length 135
organism Tupaia_belangeri
snoRNA name SNORA21
alias
chromosome ⁄ contig scaffold_146588
locus ⁄ host gene ENSTBEG00000006548
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved