snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA71
sequence
ACCTGCATTCAAAAGTGATCATGGGCTGCCTGTGCTCTGGTCGTCGACAATGCAGGGAG
AAGAATTGCTGAAAGCCGTTTCCCGTGTTTGGAGGGTTCGCGCCTGTCCCTTTCAAATGC
TGGCGCTTTCACACA
  Box motif
  Complementary to target RNA
length 134
organism Tupaia_belangeri
snoRNA name SNORA71
alias
chromosome ⁄ contig scaffold_130886
locus ⁄ host gene Poly:8:SNORA71
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved