snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA9
sequence
TAGCAAGCCTCCAGCGTGCTTGGGTCTGTGGTGACCCTTTGCATTCCTACAGTGCTTGC
CAAAGCAGTTTTGAAATGGTTTGAGGCCTTGCCCTGCTCTTTCCAGAGCAAGGTTATAGA
AATTTCAGACAATT
  Box motif
  Complementary to target RNA
length 133
organism Tupaia_belangeri
snoRNA name SNORA9
alias
chromosome ⁄ contig scaffold_110384
locus ⁄ host gene Mono:86:SNORA9
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved