snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA71
sequence
CCCTGCATTCAAAAGTGACCCTAGGCAGCCTGAGCCCTTGTCATTGATAGTGCAGGAGA
GACTTGCTGAAAGCGTTTCCCCGTGTTGAGGGTCACCCTGTCCTTCGACCCTGAAGCTTT
CGTACA
  Box motif
  Complementary to target RNA
length 125
organism Tupaia_belangeri
snoRNA name SNORA71
alias
chromosome ⁄ contig scaffold_86229
locus ⁄ host gene Mono:99:SNORA71
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved