snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD100
sequence
TGGGTGCATAATGACAACTGGCTCCTCCTACTGAGCTGCTATGAGGGAAAAAAATTGCT
AAATTCAGGACATTTA
  Box motif
  Complementary to target RNA
length 75
organism Tupaia_belangeri
snoRNA name SNORD100
alias
chromosome ⁄ contig GeneScaffold_3608
locus ⁄ host gene Mono:142:SNORD100
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved