snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA32
sequence
TGGTCATTACCAAGGCTTATGGAATGCAGTTCCTCATTTGCTGTGGACATGACCATAAA
GAAATTTCCCACTAGGTTTTCTATCTGCTACATTGTTATGTTGCTAGAAATCAGCCTATT
GGGAACATTT
  Box motif
  Complementary to target RNA
length 129
organism Tupaia_belangeri
snoRNA name SNORA32
alias
chromosome ⁄ contig GeneScaffold_4039
locus ⁄ host gene Poly:16:SNORA25
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved