snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD113
sequence
TGGATTGATGATGACTACTGGTAGTGTATGAGTCATGTCATGTACGATGAATATGTGTC
TGGAACTCTGAGGTCCAA
  Box motif
  Complementary to target RNA
length 77
organism Tupaia_belangeri
snoRNA name SNORD113
alias
chromosome ⁄ contig GeneScaffold_2266
locus ⁄ host gene Mono:222:SNORD113
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved