snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA61
sequence
ACCCTCTGACTTCCTTCCCCTTTGGAACTGAACACTGGTCTTGGTGGTAGTTAAAACGA
GGTAGTAAAAAGTAATACTGAAGCTGGCCATATGGTGGTGTAGCCTGGTATACAACATGT
GGGCTGGTTTTGAACAGGC
  Box motif
  Complementary to target RNA
length 138
organism Tupaia_belangeri
snoRNA name SNORA61
alias
chromosome ⁄ contig scaffold_4651
locus ⁄ host gene Mono:73:SNORA61
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved