snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD47
sequence
AACCAATGATGTTAATGATTCTGCCAAATGAAATAGAATGATATCACTTATAAAACCGT
TCCATTTTGATACTGAGGTT
  Box motif
  Complementary to target RNA
length 79
organism Tupaia_belangeri
snoRNA name SNORD47
alias
chromosome ⁄ contig GeneScaffold_5544
locus ⁄ host gene
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved