snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORD88
sequence
ATACCCCTACAATGTCTAGCACTGGGCTCTGACCACCCTGAGAACATATTACCCCCCGG
GGGAGTTTGAGGGG
  Box motif
  Complementary to target RNA
length 73
organism Tupaia_belangeri
snoRNA name SNORD88
alias
chromosome ⁄ contig scaffold_139286
locus ⁄ host gene
organization Mono
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved