snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA49
sequence
CATCCTTAGCCTTACTCCAGGGGTTTTCTGCCCGTAGAGTGCCCTGCCCTGACATTGCC
TGAGGAGAGAGCGAGAGCACGTTCCCCTCCCCAGAAACATGCTGTGTTCTGTGAGGCCTA
TGAATGAGTTGACAGT
  Box motif
  Complementary to target RNA
length 135
organism Tupaia_belangeri
snoRNA name SNORA49
alias
chromosome ⁄ contig scaffold_104598
locus ⁄ host gene Mono:106:SNORA49
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved