snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA3
sequence
ACCAAGACTAGAGTCACATTCTGACACAGCTATTTGTCCCGGTGTGCTAGAGTTCTCAG
AGAGAATCTCTTGGTCTTGATTCACTGGTGGGGGTGGTCAGTGTTCCTGCTAGTGCCCAA
TCAGAAACATGT
  Box motif
  Complementary to target RNA
length 131
organism Tupaia_belangeri
snoRNA name SNORA3
alias
chromosome ⁄ contig GeneScaffold_552
locus ⁄ host gene Mono:207:SNORA3
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved