snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA76
sequence
GCGCTGCCTTTGAGCCCCCGCCGCGCCTGCGCGTGGCGCCGGGGGCCAGGCTGCAGCGC
CAGAGCACATGCTTGTGCATAACTGGGGCCGTCTGTCCCTAACGCGGGCGGTCCTTTTAA
ACGCAAGCTACATGG
  Box motif
  Complementary to target RNA
length 134
organism Tupaia_belangeri
snoRNA name SNORA76
alias
chromosome ⁄ contig GeneScaffold_1234
locus ⁄ host gene Poly:14:SNORND104
organization Poly
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved