snOPY snoRNA Orthological Gene Database
Tupaia_belangeri SNORA24
sequence
TGCCAGTTCTTCACTGAGGAGTCAAATCTTCATTCCCTTCCTAGCCCTGGAATAATGTA
TTCTTGTTTATTGGTAAAGTTGTCACCATGTAATAGGGATCAGATTCAGACTTGCACGAG
TAACATTC
  Box motif
  Complementary to target RNA
length 127
organism Tupaia_belangeri
snoRNA name SNORA24
alias
chromosome ⁄ contig GeneScaffold_2803
locus ⁄ host gene Mono:130:SNORA24
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved