snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD33
sequence
CAAGTCTGTCATTGATGATCTATTTGTTTCTTGCTTTAGTTTAGCGACCATTAGAAAAC
TCACATTCACTACCATCTTAGACTTA
  Box motif
  Complementary to target RNA
length 85
organism Tetraodon_nigroviridis
snoRNA name SNORD33
alias
chromosome ⁄ contig Un
locus ⁄ host gene Mono:SNORD33
organization Mono
target RNA 18S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved