snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD10
sequence
GTATTGGGATGAAACCCATGCGTGTCAACTGAGTCTCTAAATCTCTTGTCGTGGTGTCG
ACCCAGCTGGCGTTTTGCAAGCTTGACTCGACAGCGAAGCAAGGCCTTAGAGAAATGATC
AGGACTGACTTTCTGAATGC
  Box motif
  Complementary to target RNA
length 139
organism Tetraodon_nigroviridis
snoRNA name SNORD10
alias
chromosome ⁄ contig Un
locus ⁄ host gene ENSTNIG00000004408.1
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved