snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD89
sequence
ACCTGGATGTGATGTAACAAAAGGCCGAATGAAGCTCCGCCCACAGCAGACTGTTCACA
GTGGGTGGAGCTGTGACAAAAATCGGACTGAAGCGTGTTCTGATCCGGGT
  Box motif
  Complementary to target RNA
length 109
organism Tetraodon_nigroviridis
snoRNA name SNORD89
alias
chromosome ⁄ contig Un
locus ⁄ host gene Poly:SNORD89
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved