snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SCARNA8
sequence
TGGGAGGCAGATACCTGGGCAGGCCTGAGCGCCGGCCTGTCCGCCACGCGTCCTCCCGA
CAGCATCGCTGCTCTCTGATGACCGCGGCGAGTTGAGGGAAATCGCCGCGGACAGATACG
GAGCAGACAGGC
  Box motif
  Complementary to target RNA
length 131
organism Tetraodon_nigroviridis
snoRNA name SCARNA8
alias
chromosome ⁄ contig Un
locus ⁄ host gene Mono:SCARNA8
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved