snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORD61
sequence
GCAATGATGACCTTCAGCTTTTGAGCAAGGGATGAAAATAACCTCAGCAATTCCTCTAA
GAAGTTCTGAGCTC
  Box motif
  Complementary to target RNA
length 73
organism Tetraodon_nigroviridis
snoRNA name SNORD61
alias
chromosome ⁄ contig Un
locus ⁄ host gene
organization Intronic
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved