snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis snR56
sequence
CTCGATGATGATAATTCTCACAGACCTGTACTGAAAACTGTGATTGCAACTATTAAATC
TGATG
  Box motif
  Complementary to target RNA
length 64
organism Tetraodon_nigroviridis
snoRNA name snR56
alias
chromosome ⁄ contig Un
locus ⁄ host gene Poly:SNORD25
organization Poly
target RNA 18S rRNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved