snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA76
sequence
GCACTGTCTTTGAACCTGACTGGTCCCATCAGTGACCTCTCAGGCCAAGCTACAGTGCT
AAATGAAACTTGGACTTGTTCATAACTGGGGCAACCTGGCAACAATCCCAAGTTGCTCTT
TTAAAAGCAAGTCATAGCT
  Box motif
  Complementary to target RNA
length 138
organism Tetraodon_nigroviridis
snoRNA name SNORA76
alias
chromosome ⁄ contig 17
locus ⁄ host gene Mono:SNORA76
organization Mono
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved