snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis snoU2_19
sequence
GATCAATGATGAAAAATAGCCAAATCTGAGTTCTTGGGCTCAGTTGTCCTCTGA
  Box motif
  Complementary to target RNA
length 54
organism Tetraodon_nigroviridis
snoRNA name snoU2_19
alias
chromosome ⁄ contig 16
locus ⁄ host gene Poly:snoU2_19
organization Poly
target RNA
modification type C/D
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved