snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA81
sequence
CCTTCCCTCCAAAAGCACCCTGCTGGAACTGCAGGAGCCGCACCTCGCTGGTCCGGCTC
ACGTGGCTGTGTAAGCACGGGTACACCAGGGAAGGAGAGCAAAGGCACGGGGTTGAAGAC
GAGACAGCGAGGGGCCTCTTTCTTAATGTCCAGTGTCTTCTGTCTCAAGGCCCCGTGTCA
CATGA
  Box motif
  Complementary to target RNA
length 184
organism Tetraodon_nigroviridis
snoRNA name SNORA81
alias
chromosome ⁄ contig 15
locus ⁄ host gene eif4a2
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved