snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA73
sequence
CCGACGTGGACGTCCAGCGAGCTGCTCTCCTGGCTCTGTCCTGGTGGCCTATGGGAGCG
TAGCTGTCCGGCCGAGACGTACAGTCCCGTTCCACGCCGTCGGAGACAGAGCTGTGTCCC
CGGCCTTGGCTGGTGTGGACCGGCGTCCTGCATATTCCTACATCTTCCCAAGACCTAACG
GGCCGTTGCTGGGGGGCTAAACCATGCAGTGCACAAAG
  Box motif
  Complementary to target RNA
length 217
organism Tetraodon_nigroviridis
snoRNA name SNORA73
alias
chromosome ⁄ contig 14
locus ⁄ host gene rps7
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved