snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA77
sequence
GCAGGCTCACTCTGTTCCTGGCTGCTCGCTCCAGCCTGGGACTTTTTTCGCCTGCTATA
GGAACATGCAGAATGTTCACTTTTCCACGCTTACCAACATTAAGCGGTGGGTAATGTGTT
CTGCAACATCAGC
  Box motif
  Complementary to target RNA
length 132
organism Tetraodon_nigroviridis
snoRNA name SNORA77
alias
chromosome ⁄ contig 12
locus ⁄ host gene ranbp1
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved