snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA38
sequence
TCCTCTTACAAAGGCGCACTTGCACTGGTTTGCTTGTCTGTGCGTAAGAACTGGAGGAA
AAGCAAAATGAACAGTGACGACTTTTCTCTGGCTGCACTTGCAGTTGACCTGCGTCTGTT
CAGATATTTCAATTCAA
  Box motif
  Complementary to target RNA
length 136
organism Tetraodon_nigroviridis
snoRNA name SNORA38
alias
chromosome ⁄ contig 10
locus ⁄ host gene prpf8
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved