snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SCARNA11
sequence
CTGTCGAACCATGTTAGCCGGTGGGGTTTCAGACATGTGACAAAGAGTAAGTTTGCCCA
ATAAAGGGGATGAGTTCCAAGTTGGGAGCTCCATCCTAAAGGCAGGGCAAAACATT
  Box motif
  Complementary to target RNA
length 115
organism Tetraodon_nigroviridis
snoRNA name SCARNA11
alias
chromosome ⁄ contig 8
locus ⁄ host gene chd4b
organization Intronic
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved