snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SNORA5
sequence
TGCAGCCTTGTCAAATTCAGTGTCTTCTGAAAGTGGACGTCACTGGCCAAAATGGCTGC
CACAGTAACTGTCGTTCATGGGCCCTGCCTCCCCGCATCAAGTGGGGATAAATATGTGCT
GCAGACATTA
  Box motif
  Complementary to target RNA
length 129
organism Tetraodon_nigroviridis
snoRNA name SNORA5
alias
chromosome ⁄ contig 8
locus ⁄ host gene atad2
organization Intronic
target RNA 18S rRNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved