snOPY snoRNA Orthological Gene Database
Tetraodon_nigroviridis SCARNA15
sequence
CAGGAGGTTTAAGAAGGTGAGACTACTAAAGGATATAGTCTTCACCGATACCCACCTCC
TAAAGTGAAAGCGGTAGTGTGAACCACCTGATCTCCAGAGATAGGTCCTGAGTGCTCTGC
ACCTACCTACAATC
  Box motif
  Complementary to target RNA
length 133
organism Tetraodon_nigroviridis
snoRNA name SCARNA15
alias
chromosome ⁄ contig 5
locus ⁄ host gene Mono:SCARNA15
organization Mono
target RNA
modification type H/ACA
modification site
accession no
orthologs list
multiple alignment
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved